Vetenskap | Ursprung | Skapelsetro
Splash slide linking to page: Video
Splash slide linking to page: Tidning
Splash slide linking to page: Frågor & Svar
Splash slide linking to page: Kalender

Människans 4D-genom trotsar alla naturalistiska förklaringar

30 Mar 2019

Det mänskliga genomet utgör något av det mest komplexa datoriserade operativsystem som finns i hela vårt kända universum. Det styr livets fantastiskt komplexa biokemi och fungerar med precisionen av en enda molekyl. Operativsystemet styr ett samverkande nätverk med hundratusentals proteiner. Ett underbart bevis på Guds kreativa briljans – och ett utmärkt exempel på den nydarwinistiska teorins sammanbrott. Varför det? Jo, ju komplexare man ser att livet är, desto sämre håller evolutionsteorin ihop. Man kan inte mixtra med extremt komplexa maskiner utan att de går sönder. Och de uppstår inte heller utifrån slumpmässiga förändringar.

Bild 1: En jämförelse mellan hur transkriptionen i E. coli (till vänster) kontrolleras och hur anropen i Linux (till höger) utförs. Bakteriecellen kan styra många proteinkodande gener (se de gröna linjerna längs ned). Linux, som uppenbart är ett resultat av intelligent design, ligger långt efter här eftersom det behöver många fler instruktioner på högnivå för att kontrollera relativt få utdata. Från Yan et al. 2010.1

Jag menar allvar när jag jämför genomet med ett operativsystem för datorer. Enda problemet med detta är att vi inte har några datorer att jämföra genomet med när det gäller komplexitet eller effektivitet. Analogin fungerar bara på allra mest grundläggande nivån, men detta gör också att det blir en så kraftfull jämförelse. Efter miljontals timmar av programskrivning och felsökning har vi bara lyckats frambringa ett operativsystem som kan köras på en laptop eller server – och som dessutom inte sällan kraschar. Genomet däremot kan köras på den hyperkomplexa maskin som heter kroppen. De två systemen har fullständigt olika organisationer Ett team med datavetare, biofysiker och bioinformatiker (det vill säga väl så smarta personer) har gjort en jämförelse mellan den oansenliga bakterien E.coli och operativsystemet Linux (se bild 1). Där har man då upptäckt att det konstgjorda operativsystemet är mycket mindre effektivt - eftersom det är mycket mera ”topptungt.”1 [Kodrader heter på engelska ”lines of code.” Därav jämförelsen med en ”linje” här.] Det har visat sig att det bakteriella genomet bara har ett fåtal instruktioner på hög nivå. Dessa styr sedan ett mindre antal processer på mellannivå - som i sin tur styr ett mycket stort antal proteinkodande gener. I Linux är det tvärtom. Där är det mycket mera topptungt, och därmed också betydligt mindre effektivt när det gäller att få saker genomförda. Bakterien kan göra väldigt mycket mera med avsevärt färre kontroller. Jag räknar med att studiet i genomik kommer att påverka den framtida utvecklingen för datorer.

Våra datorer använder också jämförelsevis enkla program. Programmerarna talar om ”kodrader”. I skolmatematiken fick vi lära oss att en linje är endimensionell. Så dataprogrammen är i stort sett endimensionella. Men det mänskliga genomet arbetar i fyra dimensioner. Detta är ett av de största vittnesbörden vi har om Guds kreativa briljans.

Bild 2: Början på människans Y-kromoson enligt visualiseringsverktyget Skittle Genome Visualisering Tool.2 Här kan vi se hur de många DNA-elementen upprepar sig (ränderna). Upprepningarna innehåller inga ”gener”, utan används för att hålla generna på plats i det tre-dimensionella rummet. Det större svarta området är repetitioner som sekvenseringsprojektet har hoppat över eftersom man ännu inte hade tekniken för att sekvensera högrepetitivt DNA. De fyra bokstäver som preciserar genomets första dimension har en hög packningsgrad av information men är ändå inte ens ”toppen på det isberg” som utgör genomets totala information.

Det mänskliga genomet är cirka 1,8 m långt. Alltihopa får plats i cellkärnan. För att sätta det i perspektiv – om man skulle göra ditt DNA lika tjockt som ett hårstrå så skulle det bli över 50 kilometer av DNA. Om man knycklade ihop det skulle det bli stort som en golfboll. Redan nu förstår man vilken otrolig ingenjör som Gud är.

Om vi tittar på en sekvens av DNA-bokstäver så skulle det kunna se ut som något i den här stilen:

CTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTG
GGAGCAGATTAGAGAATAAAAGCAGACTGCCTGAG
CCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATA
CTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAA
ATCTTGCTATTGCTCACTCTTTGGGTCCACACTGC
CTTTATGAGCTGTGACACTCACCGCAAAGGTCTGC
AGCTTCACTCCTGAGCCAGTGAGACCACAACCCCA
CCAGAAAGAAGAAACTCAGAACACATCTGAACATC
AGAAGAAACAAACTCCGGACGCGCCACCTTTAAGA
ACTGTAACACTCACCGCGAGGTTCCGCGTCTTCAT
TCTTGAAGTCAGTGAGACCAAGAACCCACCAATTC
CAGACACACTAGGACCCTGAGACAACCCCTAGAAG
AGCACCTGGTTGATAACCCAGTTCCCATCTGGGAT
TTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCT
CATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGG
GACCAGGGACAGCCCGTTGCATGAGCCCCTGGACT
CTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTG
GGACAGCCCTGTACATGAGCTCCTGGTCTGTAACA
CAGTTCCCCTGTGGGGATTTAGGGACTTGGGCCTT

Det här är de första 700 bokstäverna i människans Y-kromosom. Inte så särskilt imponerande, eller hur? Men om man tar samma sekvens och ersätter de fyra bokstäverna med färglagda pixlar så får man något som ser ut som bild 2.

Genomets första dimension utgörs helt enkelt av bokstävernas ordning. Verkar inte så värst komplicerat - men vi är inte klara än.

Andra dimensionen: samverkande nätverk

Genomets andra dimension hanterar samverkan mellan de olika sektionerna i DNA. Som vi sett kan första dimensionen ritas upp relativt enkelt. Men om man vill rita upp andra dimensionen måste man först rita en mängd pilar mellan olika delar i den linjära DNA-tråden. Hela det samverkande nätverket kan omöjligen ritas upp här, så därför får det räcka med ett litet exempel. Det finns mycket små enkeltrådiga RNA-molekyler som heter mikroRNA (miRNA). De har en genomsnittlig längd av 22 nukleotider och reglerar genernas funktioner. På bild 3 ser man hur en del av miRNA:s nätverk påverkar 13 gener för uppreglering i samband med ateroskleros (åderförkalkning) Man ser hur 262 st miRNA styr mot generna - vilket möjliggör 372 st alternativa regleringar. Vad som inte ingår i bild 3 är hur 33 andra gener nedregleras av 295 st miRNA när kroppen ska ta hand om tillståndet. Kom ihåg att det här bara är en ytterst liten del av genomets andra dimension!

Bild 3: En mindre del av det regleringsnätverk som består av mikroRNA och som tjänar som ett bra exempel på hur andra dimensionen i genomet fungerar. De orangefärgade områdena betecknar de 13 gener som i samband med ateroskleros uppregleras med hjälp av 262 st miRNA (de gröna prickarna). Dessa senare produceras i sin tur med hjälp av andra delar av genomet. (Efter Lin et al.20143)

Andra dimensionen hanterar sådant som specificitetsfaktorer, genetiska förstärkare, repressorer, aktivatorer samt transkriptionsfaktorer. Alla dessa består av proteiner som har sin kodning i DNA. När de framställts rör de sig sedan till andra delar i genomet - för att där slå på eller slå av olika DNA-sekvenser. Också ytterligare saker händer i dimension två. Under den process som tillverkar ett protein ”avläses” genen med hjälp av en procedur som kallas transkription. Det innebär att DNA-informationen kopieras över till en molekyl som heter RNA. På CMI:s webbplats finns en utmärkt animering som visar detta. Och under en process som kallas post-transkriptionell reglering kan RNA sedan inaktiveras eller aktiveras med hjälp av olika faktorer (exempelvis miRNA). Dessa faktorer finns kodade på andra ställen i genomet.

Det stora mångmiljonprogrammet ENCODE har avslöjat något om genomet som man fortfarande inte förstår fullt ut. Ett av de största mysterierna är hur bara 22 000 gener kan producera över 300 000 olika proteiner. Svaret är att det förekommer något som kallas alternativ splitsning i cellen. Generna ”klipps och klistras" (extern länk) - olika delar sammanfogas vid olika tillfällen och olika celler kan använda samma information och ändå prducera olika proteiner. Denna otroligt komplicerad process är bara en del av den andra dimensionens verksamhet i genomet.

Tredje dimensionen: 3D-struktur i DNA

Den tredje dimensionen innebär att den strukturella utformningen av DNA-molekylen påverkar både uttryck och kontroll av de olika generna. Vi har sett att det är svårt att komma åt de sektioner av DNA som ligger djupt begravda i den hoplindade spiralen.4 Därför ligger kodningen vanligen lättåtkomlig för de gener som behövs ofta. När Gud skrev ut arvsmassans information längst den endimensionella tråden, lade han det hela i en sådan ordning att det skulle komma på rätt plats när DNA veckade ihop sig till en tredimensionell form.

Bild 4: Tredimensionell positionering av kromosomerna i cellkärnan. Djup begravda gener är svåra att nå, varför genomets 3D-veckning är av största betydelse för dess funktion.(Från Bolzer5)

Ett av de stora avslöjanden, som kom fram under Human Genom Projekt, var att gener som används tillsammans inte nödvändigtvis ligger i närheten av varandra i genomet. De långa ”överflödiga” sekvenserna i mellanrummen betraktades som ”bara skräp” eller ”många miljoner års ansamling av genetiska olyckor.” Påståendena fick dock inte vara oemotsagda så länge. När man väl hade börjat undersöka hur genomet var organiserat i cellkärnan upptäckte man något mycket intressant.5 Man såg att det inte bara var så att varje kromosom hade sin bestämda plats i kärnan, utan också att de gener som användes tillsammans kunde hittas bredvid varandra i det tredimensionella rummet – även om de låg på olika kromosomer!

Fjärde dimensionen: Förändringar i de tre första dimensionerna

Genomets fjärde dimension handlar om att de tre första dimensionerna förändras i dimension fyra, det vill säga i tiden. Ja, du läste rätt. Utformningen (3:e dimensionen), nätverket för samverkan (2:a dimensionen) och sekvensen av bokstäver (1:a dimensionen) är alla föremål för förändring. Än så länge överträffar det här även våra allra modernaste datorer – och detta i så hög grad att det inte ens är rimligt med en jämförelse.

Vi kan illustrera den här fjärde dimensionen på olika sätt. Vi vet att olika leverceller har olika antal kromosomer.6 Det beror på att levern behöver mängder av kopior av en del gener som har med ämnesomsättningen och avgiftningen att göra. I stället för att fylla upp genomet med mängder av genkopior gör levern egna kopior av dem. Vi vet också att olika hjärnceller har varierande antal och placeringar av transposoner.7 Här har vi dessa ”hoppande gener” som evolutionisterna tror är rester av tidigare virusinfektioner. Problemet är då att de är nödvändiga för hjärnans utveckling. Fick du tag i det? Genomet omprogrammerar sig självt. Detta är något som dataforskare länge har kämpat med. Hur ska man kunna åstadkomma en självmodifierande kod utan att man tappar kontrollen? Vi vet också att transposonerna är nödvändiga för kontroll av utvecklingen av embryo hos möss.8 Inte särskilt lyckat då att kalla dem ”skräp-DNA"! (extern länk)

Sammanfattning

Genomet är ett flerdimensionellt operativsystem avsett för en ultrakomplex biologisk dator. Det har inbyggda koder för felrättning och självmodifiering. Det finns ett flertal överlappande DNA-koder, RNA-koder samt strukturella koder. Genomet har avsikligt utformats med en betydande redundans. En brilliant intelligens har här använt sunda tekniska konstruktionsprinciper. Det finns gener i DNA och gener i RNA. Trots den höga redundansgraden uppvisas en fantastiskt hög packningsgrad av information. Med bara 22.000 proteinkodande gener kan systemet skapa flera hundra tusen separata proteiner.

Nu vill jag utmana evolutionisterna till att förklara hur genomet bildats. Charles Darwin skrev i Arternas uppkomst följande:

Om det kunde påvisas att det existerade något komplext organ vilket som helst, som absolut inte skulle ha kunnat formas av otaliga, på varandra följande, små förändringar, skulle min teori utan vidare bryta samman.

Jag vet att citatet har missbrukats (från båda sidor i debatten) - men låt oss ändå fundera lite på det här ett tag. Ju enklare livet är desto lättare blir det att förklara det utifrån darwinistiska termer. Å andra sidan, ju komplexare livet är, desto mer svårhanterligt blir det i evolutionsteorin. Vi har just sett att genomet är raka motsatsen till att vara enkelt, så det här borde få darwinisterna att känna sig väldigt obekväma.

Jag hävdar att genomet inte kan ha uppkommit genom några kända naturalistiska processer. Den evolutionist som vill utmana mitt påstående måste visa att det finns ett fungerande scenario. Man måste kunna peka ut källan till informationsförändringarna och redogöra för hur den nödvändiga mängden av mutationer uppkommit samt kunna beskriva de nödvändiga selektiva krafterna – allt detta inom en korrekt tidsram. Man kommer att upptäcka att evolutionen inte kan åstadkomma det som behövs – ej ens under miljontals år.

Ja, det här var en kort sammanfattning av den information som du kan ta del av i DVD:n The High Tech Cell. Så om du vill veta mer föreslår jag att du köper den från CMI:s webbutik.

Referenser

  1. Yan, K.-K., et al., Comparing genomes to computer operating systems in terms of the topology and evolution of their regulatory control networks. PNAS 107(20):9186-9191, 2010.
  2. Seaman, J., and Sanford, J., Skittle: a 2-dimensional genome visualization tool. BMC Bioinformatics 10:452, 2009.
  3. Lin, M., Zhao, W., and Weng, J., Dissecting the mechanism of carotid atherosclerosis from the perspective of regulation, International Journal of Molecular Medicine 34:1458-1466, 2014.
  4. van Berkum, N.L., Hi-C: a method to study the three-dimensional architecture of genomes, Journal of Visualized Experiments 6(39):1869, 2010.
  5. Bolzer, A., et al., Three-dimensional maps of all chromosomes in human male fibroblast nuclei and prometaphase rosettes, PLoS Biol 3(5):e157, 2005.
  6. Duncan, A.W., et al., The ploidy conveyor of mature hepatocytes as a source of genetic variation, Nature 467:707-710, 2010.
  7. Baillie, J.K., et al., Somatic retrotransposition alters the genetic landscape of the human brain, Nature 479:534-537, 2011.
  8. Tomkins, J., 2012. Transposable Elements Key in Embryo Development; icr.org/article/6928, July 25, 2012.
Prenumerera på vårt nyhetsbrev!

Missa inget nytt från Genesis - Anmäl dig i formuläret nedan för att få vårt nyhetsbrev rakt i din e-postlåda någon gång per månad! (Ett nytt fönster öppnas då, där ni får bekräfta er e-postadress)

OBS, Genom att anmäla dig, godkänner du vår policy för behandling av personuppgifter. Läs därför den först, innan du anmäler dig.

*-markerade fält är obligatoriska.
Fler frågor & Svar » Fler videor » Fler händelser » Fler blogginlägg »